ID: 1026482455_1026482470

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1026482455 1026482470
Species Human (GRCh38) Human (GRCh38)
Location 7:70790405-70790427 7:70790452-70790474
Sequence CCCTTCTTTCCACTGGGACCCCA ACCGAGAACTTGACATTCACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 319} {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!