ID: 1026493211_1026493213

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1026493211 1026493213
Species Human (GRCh38) Human (GRCh38)
Location 7:70881014-70881036 7:70881033-70881055
Sequence CCTGATGAGGGAGACCACAGGAT GGATAAAGCAACATTAAGCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!