ID: 1026523398_1026523403

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1026523398 1026523403
Species Human (GRCh38) Human (GRCh38)
Location 7:71134767-71134789 7:71134782-71134804
Sequence CCTGGTTTCCCTCATCAGGCTTT CAGGCTTTTCTCAGGGACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 31, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!