ID: 1026580060_1026580064

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1026580060 1026580064
Species Human (GRCh38) Human (GRCh38)
Location 7:71608313-71608335 7:71608335-71608357
Sequence CCACTTGCCACTCATGCAGTTGC CTGGCTCCATCCATCTACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 155} {0: 1, 1: 0, 2: 0, 3: 6, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!