|
Left Crispr |
Right Crispr |
| Crispr ID |
1026608774 |
1026608781 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:71838702-71838724
|
7:71838743-71838765
|
| Sequence |
CCCCATTCTGCAGTTCTGGTGAT |
ACATCTGATGGTTTTATAAGGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 39, 1: 3153, 2: 7014, 3: 7278, 4: 4328} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|