ID: 1026649938_1026649941

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1026649938 1026649941
Species Human (GRCh38) Human (GRCh38)
Location 7:72208133-72208155 7:72208181-72208203
Sequence CCTCAGATGGCATTCACTTATTT AAATCCTGATTCACATAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 211} {0: 1, 1: 0, 2: 4, 3: 45, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!