|
Left Crispr |
Right Crispr |
| Crispr ID |
1026664540 |
1026664545 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:72331097-72331119
|
7:72331120-72331142
|
| Sequence |
CCCAGCACTTTGGGAGGCCAAGG |
CAGGTAGATTACCTGAAGTCAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 2, 1: 134, 2: 3413, 3: 33370, 4: 76792} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|