ID: 1026665220_1026665228

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1026665220 1026665228
Species Human (GRCh38) Human (GRCh38)
Location 7:72336014-72336036 7:72336049-72336071
Sequence CCACCTGGGCGCCAGACCCATCC CTCAGAGACTAGGTCCCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!