ID: 1026670211_1026670214

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1026670211 1026670214
Species Human (GRCh38) Human (GRCh38)
Location 7:72383651-72383673 7:72383664-72383686
Sequence CCTCTAAGGAAGTGTTCTGGGAA GTTCTGGGAAGGGACAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!