ID: 1026735529_1026735542

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1026735529 1026735542
Species Human (GRCh38) Human (GRCh38)
Location 7:72946339-72946361 7:72946378-72946400
Sequence CCCGGATCTCTGGCTTCAGCCGC CCCTGGGGCCCTTTCCCTTCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 4, 3: 35, 4: 332} {0: 3, 1: 0, 2: 2, 3: 33, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!