ID: 1026735546_1026735558

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1026735546 1026735558
Species Human (GRCh38) Human (GRCh38)
Location 7:72946387-72946409 7:72946421-72946443
Sequence CCTTTCCCTTCTGGAGGAAGCAC AAGGGGAAGCAGGATGCGGAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 4, 3: 21, 4: 261} {0: 3, 1: 0, 2: 0, 3: 41, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!