ID: 1026785886_1026785896

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1026785886 1026785896
Species Human (GRCh38) Human (GRCh38)
Location 7:73301323-73301345 7:73301351-73301373
Sequence CCTTCTGGAGGAAGCACAAGCCT AAGGGGAAGCAGGATGCGGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 0, 3: 41, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!