ID: 1026789145_1026789148

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1026789145 1026789148
Species Human (GRCh38) Human (GRCh38)
Location 7:73320341-73320363 7:73320355-73320377
Sequence CCCAGGGAAACCAGGGCGGGAAC GGCGGGAACCAGAGCCACCCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 5, 4: 128} {0: 3, 1: 0, 2: 1, 3: 24, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!