ID: 1026817130_1026817145

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1026817130 1026817145
Species Human (GRCh38) Human (GRCh38)
Location 7:73521897-73521919 7:73521945-73521967
Sequence CCAGCGGGAAGGGCTTGCGGCCC CGGTGGGGACTGGCGGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 100} {0: 1, 1: 0, 2: 1, 3: 25, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!