ID: 1026824607_1026824609

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1026824607 1026824609
Species Human (GRCh38) Human (GRCh38)
Location 7:73573659-73573681 7:73573679-73573701
Sequence CCTTTAGTTTCTCTCTAGGGTTT TTTAGAAACTAAGGCTCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 262} {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!