ID: 1026831528_1026831538

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1026831528 1026831538
Species Human (GRCh38) Human (GRCh38)
Location 7:73613156-73613178 7:73613179-73613201
Sequence CCTCCCCACTCCCGTGAAGCCCA CCTTCAAACCTTTGGCGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 243} {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!