ID: 1026841528_1026841539

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1026841528 1026841539
Species Human (GRCh38) Human (GRCh38)
Location 7:73671911-73671933 7:73671955-73671977
Sequence CCAGACCCTGGGGCAAGGTAGGC GGTGAGAGTGGGCCATACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 214} {0: 1, 1: 0, 2: 2, 3: 13, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!