ID: 1026841532_1026841539

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1026841532 1026841539
Species Human (GRCh38) Human (GRCh38)
Location 7:73671917-73671939 7:73671955-73671977
Sequence CCTGGGGCAAGGTAGGCCAGGGG GGTGAGAGTGGGCCATACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 324} {0: 1, 1: 0, 2: 2, 3: 13, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!