ID: 1026843270_1026843278

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1026843270 1026843278
Species Human (GRCh38) Human (GRCh38)
Location 7:73682895-73682917 7:73682932-73682954
Sequence CCAGTTGTTCCCCGTAGTGGGCC AAAGTTGAACATCGTGCGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33} {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!