ID: 1026850196_1026850206

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1026850196 1026850206
Species Human (GRCh38) Human (GRCh38)
Location 7:73719178-73719200 7:73719197-73719219
Sequence CCCACCGCGGTCCCCTCGTCTGT CTGTCTACACCGAGGGGGCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!