ID: 1026853415_1026853420

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1026853415 1026853420
Species Human (GRCh38) Human (GRCh38)
Location 7:73738442-73738464 7:73738455-73738477
Sequence CCTGTAGGAAAGCGGAAGCGGCC GGAAGCGGCCTGGCAGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72} {0: 1, 1: 0, 2: 13, 3: 152, 4: 659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!