ID: 1026887912_1026887915

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1026887912 1026887915
Species Human (GRCh38) Human (GRCh38)
Location 7:73965204-73965226 7:73965221-73965243
Sequence CCAGGCTCAAAGACCAGGAGGCT GAGGCTGCCCAGAGATTAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!