ID: 1026902588_1026902598

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1026902588 1026902598
Species Human (GRCh38) Human (GRCh38)
Location 7:74045260-74045282 7:74045302-74045324
Sequence CCCACTGGAGCAGGAGTTAAGCC CTGTCTGGACAGAGGGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94} {0: 1, 1: 1, 2: 0, 3: 28, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!