ID: 1026911756_1026911761

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1026911756 1026911761
Species Human (GRCh38) Human (GRCh38)
Location 7:74095180-74095202 7:74095200-74095222
Sequence CCAGGTCCCAGTCTTTCCTACCT CCTGCCTCTCTCCTAGATTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 114, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!