ID: 1026915305_1026915310

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1026915305 1026915310
Species Human (GRCh38) Human (GRCh38)
Location 7:74116481-74116503 7:74116501-74116523
Sequence CCAGCGTCAGCCTCACCGGGCTG CTGAAATCAAGACGCCGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 335} {0: 1, 1: 0, 2: 2, 3: 46, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!