ID: 1026929378_1026929386

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1026929378 1026929386
Species Human (GRCh38) Human (GRCh38)
Location 7:74215402-74215424 7:74215455-74215477
Sequence CCTGAGTTGCTCTGGGGTGGGCG GGCCACAGACTGTCACCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!