ID: 1026930672_1026930683

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1026930672 1026930683
Species Human (GRCh38) Human (GRCh38)
Location 7:74221469-74221491 7:74221519-74221541
Sequence CCCAGGAAGTGGGGGTGGGGGAA ATGGCCCCCAAGAGGAGCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 84, 4: 686} {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!