ID: 1026960360_1026960369

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1026960360 1026960369
Species Human (GRCh38) Human (GRCh38)
Location 7:74404020-74404042 7:74404066-74404088
Sequence CCAGGACGCTTCCTCAAGCCCAG TACAGCCCCGGCCTGACCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 170} {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!