ID: 1026963785_1026963790

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1026963785 1026963790
Species Human (GRCh38) Human (GRCh38)
Location 7:74426443-74426465 7:74426465-74426487
Sequence CCCTTAATTCACTGATAGGGAAA ACGGAGGCCCAGAGAGGCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 42, 3: 304, 4: 1132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!