ID: 1026972341_1026972350

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1026972341 1026972350
Species Human (GRCh38) Human (GRCh38)
Location 7:74476064-74476086 7:74476079-74476101
Sequence CCTCTTCTCCAATGCCTGGTGGT CTGGTGGTGGTGAGGGATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 186} {0: 1, 1: 1, 2: 8, 3: 165, 4: 1265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!