ID: 1026979394_1026979409

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1026979394 1026979409
Species Human (GRCh38) Human (GRCh38)
Location 7:74517806-74517828 7:74517853-74517875
Sequence CCTCTGCTCTGTCCTCTGGGCCC CCAGGTGCCCAGAGTGGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 45, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!