ID: 1026981267_1026981269

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1026981267 1026981269
Species Human (GRCh38) Human (GRCh38)
Location 7:74528128-74528150 7:74528168-74528190
Sequence CCTTTAGCCATTTGTATATTCAC GTGTGTGCCCAGCCCCATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 289} {0: 1, 1: 0, 2: 5, 3: 27, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!