ID: 1026987713_1026987723

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1026987713 1026987723
Species Human (GRCh38) Human (GRCh38)
Location 7:74565115-74565137 7:74565152-74565174
Sequence CCGCAAGGGGCTGAGACAACCCA GGCTGAACGCCATTGGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 201} {0: 1, 1: 1, 2: 0, 3: 4, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!