ID: 1026990480_1026990485

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1026990480 1026990485
Species Human (GRCh38) Human (GRCh38)
Location 7:74582342-74582364 7:74582370-74582392
Sequence CCCAAGGAGCTGCCTCTGGTGCA AGTTCCCAGAAGATCTGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 3, 3: 38, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!