ID: 1027008968_1027008972

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1027008968 1027008972
Species Human (GRCh38) Human (GRCh38)
Location 7:74725299-74725321 7:74725333-74725355
Sequence CCATGTTCCATATGACTTAAAAC AATTAATAAGTTTATGAAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 50, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!