ID: 1027011135_1027011140

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1027011135 1027011140
Species Human (GRCh38) Human (GRCh38)
Location 7:74745785-74745807 7:74745829-74745851
Sequence CCTTTAGAAAAAAAACCCTGATC CTGTGAGGCCACCACTGTGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 27, 4: 320} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!