ID: 1027036573_1027036581

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1027036573 1027036581
Species Human (GRCh38) Human (GRCh38)
Location 7:74930007-74930029 7:74930046-74930068
Sequence CCTTCCAACAACTCTATAGGGTG TTAACAGAGAAGGAAAATGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 16, 3: 141, 4: 1104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!