ID: 1027086981_1027086988

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1027086981 1027086988
Species Human (GRCh38) Human (GRCh38)
Location 7:75271417-75271439 7:75271455-75271477
Sequence CCTCATTTTCCTTCTCTGTTAAT CACCCTATAGAGTTGTTGGAAGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 17, 3: 526, 4: 3635} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!