|
Left Crispr |
Right Crispr |
Crispr ID |
1027111548 |
1027111558 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:75443679-75443701
|
7:75443709-75443731
|
Sequence |
CCTGTATTCCCAGCACTTCGAAG |
CGGGCGGATCACCTGAGGTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 1, 2: 176, 3: 4436, 4: 38511} |
{0: 5169, 1: 39885, 2: 101917, 3: 112252, 4: 95582} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|