ID: 1027117997_1027118001

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1027117997 1027118001
Species Human (GRCh38) Human (GRCh38)
Location 7:75496213-75496235 7:75496235-75496257
Sequence CCTGTCTCTTCTAGAAGCACAAA AAATGAGCTGGGCGTTCTGGTGG
Strand - +
Off-target summary No data {0: 7, 1: 4, 2: 346, 3: 13246, 4: 49677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!