ID: 1027126403_1027126420

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1027126403 1027126420
Species Human (GRCh38) Human (GRCh38)
Location 7:75559695-75559717 7:75559726-75559748
Sequence CCCCCGGGGCCCGCCCCCGCCCC GCTCACTTTCTATCTCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 41, 3: 332, 4: 2007} {0: 1, 1: 0, 2: 0, 3: 11, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!