ID: 1027139725_1027139735

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1027139725 1027139735
Species Human (GRCh38) Human (GRCh38)
Location 7:75648590-75648612 7:75648631-75648653
Sequence CCAGGTGCACCCCCAGAACCTTT CCCCTAAGCTGCCGGAAGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!