|
Left Crispr |
Right Crispr |
| Crispr ID |
1027156369 |
1027156375 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:75771175-75771197
|
7:75771211-75771233
|
| Sequence |
CCTGGGCTCAAGCGATCGTCTAA |
GTACAACTCCACCAATTTAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 522, 3: 8043, 4: 44514} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|