ID: 1027160046_1027160048

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1027160046 1027160048
Species Human (GRCh38) Human (GRCh38)
Location 7:75795806-75795828 7:75795824-75795846
Sequence CCACAAAACTCATGGATGGCAGA GCAGAACCAAGGCTCAGAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 44, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!