ID: 1027202203_1027202213

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1027202203 1027202213
Species Human (GRCh38) Human (GRCh38)
Location 7:76071471-76071493 7:76071512-76071534
Sequence CCGCTGTCAGGCAGTGGCTGGGA AGCCGAAGGCGGGGCCTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 366} {0: 1, 1: 2, 2: 5, 3: 20, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!