ID: 1027223107_1027223121

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1027223107 1027223121
Species Human (GRCh38) Human (GRCh38)
Location 7:76226483-76226505 7:76226528-76226550
Sequence CCTCAGTTGAACTCTAAGGGTGG CTGTATCAGCAGAAAGGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 41, 4: 520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!