ID: 1027228801_1027228816

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1027228801 1027228816
Species Human (GRCh38) Human (GRCh38)
Location 7:76260681-76260703 7:76260716-76260738
Sequence CCCCTCTGCCCTCCCAGGGGTCC CACTAGTGCGAGTGGCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 70, 4: 654} {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!