ID: 1027230065_1027230075

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1027230065 1027230075
Species Human (GRCh38) Human (GRCh38)
Location 7:76267465-76267487 7:76267490-76267512
Sequence CCGCGCCGCGGGCTGCGCCGTGC GGTCGGGCGGGTCGCCAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 156} {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!