ID: 1027232990_1027232999

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1027232990 1027232999
Species Human (GRCh38) Human (GRCh38)
Location 7:76282764-76282786 7:76282803-76282825
Sequence CCCGCTCCTGGAGCTCCAGCCGC GCTCGCGCTCTGCGGAGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 578} {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!