ID: 1027250354_1027250364

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1027250354 1027250364
Species Human (GRCh38) Human (GRCh38)
Location 7:76395087-76395109 7:76395139-76395161
Sequence CCTTGCTCCGTCTGCTCATAATT AAGCCCTGGCCTGTTAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98} {0: 1, 1: 0, 2: 2, 3: 7, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!